ЛитМир - Электронная Библиотека
A
A

»Es ist neun Uhr.«

Johanson setzte sich auf.

Er war nach wie vor in dem Zimmer. Inzwischen ging es ihm bedeutend besser. Die Übelkeit war verschwunden, der schraubstockartige Schmerz einem dumpfen, aber erträglichen Druck gewichen.

Nur wie er hierher gekommen war, wusste er immer noch nicht.

Er sah an sich hinunter. Hemd, Hose, Socken, alles von letzter Nacht. Seine Daunenjacke und sein Pullover lagen auf dem Bett nebenan, davor standen die Schuhe, akkurat nebeneinander platziert.

Er schwang die Beine über die Bettkante.

Sofort ging eine Tür auf, und Sid Angeli kam herein, der Leiter der medizinischen Versorgung. Angeli war ein kleiner Italiener mit Haarkranz und scharfen Mundwinkelfalten, der den ödesten Job auf dem Schiff hatte, weil niemand krank wurde. Das schien sich seit kurzem geändert zu haben. »Wie geht es Ihnen?« Angeli legte den Kopf schief. »Alles in Ordnung?«

»Weiß nicht.« Johanson griff in seinen Nacken und zuckte heftig zusammen.

»Das wird noch eine Weile wehtun«, sagte Angeli. »Machen Sie sich nichts draus. Hätte schlimmer kommen können.«

»Was ist denn überhaupt passiert?«

»Haben Sie keine Erinnerung?«

Johanson dachte nach, aber Nachdenken brachte nur den Schmerz zurück. »Ich glaube, ich könnte zwei Aspirin vertragen«, stöhnte er.

»Sie wissen nicht, was vorgefallen ist?«

»Keine Ahnung.«

Angeli kam näher und schaute ihm prüfend ins Gesicht. »Tja. Sie wurden auf dem Hangardeck gefunden heute Nacht. Müssen ausgerutscht sein. Ein Segen, dass hier alles videoüberwacht wird, sonst lägen Sie immer noch da. Sind wahrscheinlich mit Genick und Hinterkopf auf eine Bodenverstrebung geknallt.«

»Hangardeck?«

»Ja. Wissen Sie nicht mehr?«

Natürlich, er war auf dem Hangardeck gewesen. Mit Oliviera. Und danach ein weiteres Mal, allein. Er konnte sich erinnern, dass er dorthin zurückgekehrt war, aber nicht mehr, warum. Und schon gar nicht, was dann passiert war.

»Hätte ein böses Ende nehmen können«, sagte Angeli. »Sie … ähm … haben da nicht zufällig was getrunken?«

»Getrunken?«

»Wegen der leeren Flasche. Da lag eine leere Flasche rum. Miss Oliviera meinte, Sie hätten dort gemeinsam was getrunken.« Angeli spreizte die Finger. »Verstehen Sie mich nicht falsch, Dottore, das ist überhaupt nicht schlimm. Aber Flugzeugträger sind gefährliche Orte. Nass und dunkel. Man kann stürzen oder ins Meer fallen. Besser, nicht allein aufs Deck zu gehen, vor allem nicht, wenn man … äh …«

»Wenn man was getrunken hat«, ergänzte Johanson. Er stellte sich auf die Füße. Schwindel durchraste seinen Kopf. Angeli eilte hinzu und nahm seinen Ellbogen. »Danke, es geht.« Johanson schüttelte ihn ab. »Wo bin ich hier überhaupt?«

»Auf der Krankenstation. Kommen Sie zurecht?«

»Wenn Sie mir die Aspirin geben würden …«

Angeli ging zu einem weiß lackierten Schubladenschrank und entnahm ihm ein Päckchen Schmerztabletten. »Hier. Ist nur eine dicke Beule. Wird Ihnen bald besser gehen.«

»Okay. Danke.«

»Fühlen Sie sich wirklich gut?«

»Ja.«

»Und Sie erinnern sich an nichts?«

»Nein, zum Teufel.«

»Va bene.« Angeli lächelte breit. »Beginnen Sie den Tag langsam, Dottore. Und wenn irgendetwas ist, scheuen Sie sich nicht, sofort herzukommen.«

Flagg-Besprechungsraum

»Hypervariable Bereiche? Ich verstehe kein Wort.«

Vanderbilt versuchte mitzukommen. Oliviera merkte, dass sie Gefahr lief, ihre Zuhörerschaft zu überfordern. Peak schaute irritiert drein. Li ließ sich nichts anmerken, aber es stand zu befürchten, dass der Vortrag ihr Wissen über Genetik arg strapazierte.

Johanson saß zwischen ihnen wie ein Gespenst. Er war verspätet erschienen, ebenso wie Rubin, der verlegen murmelnd Platz genommen und sich für seinen Ausfall entschuldigt hatte. Im Gegensatz zu Rubin sah Johanson wirklich schlecht aus. Sein Blick flackerte. Er schaute um sich, als müsse er sich alle paar Minuten versichern, dass die Personen ringsum echt waren und keine Einbildung. Oliviera nahm sich vor, nach dem Meeting mit ihm zu sprechen.

»Ich will es am Beispiel einer normalen menschlichen Zelle deutlich machen«, sagte sie. »Sie ist im Grunde nichts weiter als ein Sack voller Informationen mit einer Membran drum herum. Der Kern enthält die Chromosomen, die Gesamtheit aller Gene. Sie bilden zusammen das Genom oder die DNA, diese spiralige Doppelhelix, Sie wissen schon. Salopp ausgedrückt, unseren Bauplan. Je höher ein Organismus entwickelt ist, desto differenzierter fällt dieser Bauplan aus. Anhand einer DNA-Analyse können Sie einen Mörder überführen oder verwandtschaftliche Verhältnisse klären, aber im Großen und Ganzen ist der Plan bei allen Menschen gleich: Füße, Beine, Torso, Arme, Hände, und so weiter. Das heißt, die Analyse einer individuellen DNA sagt uns zweierlei — im Allgemeinen: Dies ist ein Mensch. Im Besonderen, um welche Person es sich handelt.«

Sie sah Interesse und Verständnis in den Gesichtern der anderen. Offenbar war es eine gute Idee gewesen, mit einem Grundkurs in Genetik zu beginnen.

»Natürlich sind zwei Menschen individuell unterschiedlicher als zwei Einzeller desselben Stammes. Meine DNA weist statistisch rund eine Million kleiner Unterschiede zu jeder anderen Person im Raum auf. Alle 1200 Basenpaare differieren menschliche Wesen voneinander. Wiederum, wenn Sie die Zellen von ein und derselben Person untersuchen, werden Sie auch dort minimale Unterschiede feststellen, biochemische Abweichungen in der DNA, entstanden durch Mutation. Entsprechend unterschiedlich können die Ergebnisse ausfallen, wenn Sie etwa eine Zelle von meiner linken Hand und eine von meiner Leber analysieren. Dennoch sagt jede davon eindeutig: Es handelt sich um Sue Oliviera.« Sie machte eine Pause. »Bei Einzellern stellen sich solche Fragen weniger. Es gibt nur eine einzige Zelle. Sie bildet das gesamte Wesen. Es gibt also auch nur ein Genom, und weil sich Einzeller durch Teilung vermehren statt durch Paarung, findet auch keine Chromosomenvermischung von Mama und Papa statt, sondern das Wesen dupliziert sich mitsamt seiner genetischen Information, und das war’s.«

»Das heißt, auf Einzeller bezogen — sobald man eine DNA kennt, kennt man alle«, sagte Peak mit Worten, die auf einem Hochseil zu balancieren schienen.

»Ja.« Oliviera schenkte ihm ein Lächeln. »Das wäre nur natürlich. Eine Population von Einzellern wird sich durch weitgehend identische Genome ausweisen. Die geringe Mutationsrate außer Acht gelassen, ist die DNA in jedem Individuum gleich.«

Sie sah, wie Rubin unruhig auf seinem Stuhl hin— und herzurutschen begann und seinen Mund auf-und zuklappte. Normalerweise hätte er spätestens an dieser Stelle versucht, den Vortrag an sich zu reißen. Wie dumm, dachte Oliviera befriedigt, dass du mit Migräne im Bett gelegen hast. Zur Abwechslung weißt du mal nicht, was wir wissen. Du musst die Schnauze halten und zuhören.

»Aber genau hier beginnt unser Problem«, fuhr sie fort. »Die Zellen der Gallerte wirken auf den ersten Blick identisch. Es sind Amöben, wie man sie in der Tiefsee findet. Nicht mal sonderlich exotisch. Um ihre ganze DNA zu beschreiben, müssten wir diverse Computer zwei Jahre lang rechnen lassen, also beschränken wir uns auf Stichproben. Wir isolieren kleine Abschnitte der DNA und erhalten Teile des genetisehen Codes, technisch ausgedrückt sogenannte Amplicons. Jedes Amplicon zeigt uns eine Reihe von Basenpaaren, genetisches Vokabular. Analysieren wir Amplicons aus dem jeweils gleichen Abschnitt der DNA unterschiedlicher Individuen und vergleichen sie miteinander, erhalten wir interessante Informationen. Die Amplicons mehrerer Einzeller derselben Population etwa sollten folgendes Bild ergeben.«

Sie hielt einen Ausdruck hoch, den sie für das Meeting vergrößert hatte.

Al: AATGCCAATTCCATAGGATTAAATCGA A2: AATGCCAATTCCATAGGATTAAATCGA A3: AATGCCAATTCCATAGGATTAAATCGA A4: AATGCCAATTCCATAGGATTAAATCGA

206
{"b":"744","o":1}