ЛитМир - Электронная Библиотека
A
A

»Sie sehen, die analysierten Sequenzen sind auf ganzer Strecke identisch. Vier identische Einzeller.« Sie legte das Blatt zur Seite und zeigte ein zweites. »Stattdessen haben wir das hier erhalten.«

A1: AATGCCACGATGCTACCTGAAATCGA A2: AATGCCAATTCCATAGGATTAAATCGA A3: AATGCCAGGAAATTACCCGAAATCGA A4: AATGCCATTTGGAACAAATAAATCGA

»Das sind die Basenabfolgen der Amplicons von vier Exemplaren unserer Gallertspezies. Die DNA ist identisch — bis auf kleine, hypervariable Bereiche, in denen es drunter und drüber geht. Keinerlei Gemeinsamkeiten. Wir haben Dutzende der Zellen untersucht. Manche differieren innerhalb der hypervariablen Zonen nur leicht, andere sind völlig unterschiedlich. Durch natürliche Mutation ist so was nicht mehr zu erklären. Anders gesagt: Das kann kein Zufall sein.«

»Vielleicht sind es doch unterschiedliche Arten«, sagte Anawak.

»Nein. Es ist definitiv dieselbe Spezies. Und definitiv ist jedem Lebewesen zu Eigen, dass seine genetische Codierung zu Lebzeiten nicht verändert werden kann. Der Bauplan kommt immer als Erstes. Erst danach wird gebaut, und was fertig gebaut ist, kann nur diesem Plan entsprechen und keinem anderen.«

Lange Zeit sagte niemand etwas.

»Wenn diese Zellen trotzdem unterschiedlich sind«, sagte Anawak, »müssen sie also einen Weg gefunden haben, ihre DNA zu verändern, nachdem sie sich geteilt haben.«

»Aber zu welchem Zweck?«, fragte Delaware.

»Menschen«, sagte Vanderbilt.

»Menschen?«

»Sind denn hier alle blind? Die Natur macht so was nicht, sagt Dr. Oliviera, die es wissen muss, und von Dr. Johanson höre ich auch keinen Einspruch. Also wer hat Grips genug, sich so was auszudenken, he? Das Zeug ist eine Biowaffe. Nur Menschen bringen so was fertig.«

»Einspruch«, sagte Johanson. Er fuhr sich durchs Haar. »Es ergibt keinen Sinn, Jack. Der Vorteil von Biowaffen ist, dass man nur ein Basisrezept braucht. Der Rest ist Reproduktion …«

»Es kann durchaus von Vorteil sein, wenn Viren Mutationen durchlaufen, oder nicht? Das AIDS-Virus mutiert am laufenden Band. Jedes Mal, wenn man glaubt, ihm auf die Schliche gekommen zu sein, hat es sich schon wieder verändert.«

»Das ist was anderes. Wir haben hier einen Superorganismus, keine virologische Infektion. Es muss einen anderen Grund haben, warum sie unterschiedlich sind. Irgendetwas geschieht mit ihrer DNA nach der Teilung. Sie werden anders codiert, unterschiedlich. Wen interessiert, wer dafür verantwortlich ist? Wir müssen rausfinden, welchen Sinn es hat.«

»Es hat den Sinn, uns alle zu töten!«, sagte Vanderbilt gereizt. »Dieses Zeug ist dazu da, die freie Welt zu vernichten.«

»Schön«, knurrte Johanson. »Dann erschießen Sie es doch. Sollen wir nachsehen, ob es muslime Zellen sind? Vielleicht ist Ihre DNA islamisch fundamentalistisch. Würde die Sache legitimieren.«

Vanderbilt starrte ihn an. »Auf welcher Seite stehen Sie eigentlich?«

»Auf der des Verstehens.«

»Verstehen Sie auch, warum Sie gestern Nacht auf den Kopf gefallen sind?« Vanderbilt grinste süffisant. »Nach dem Genuss einer Flasche Bordeaux, wohlgemerkt. Wie geht es Ihnen, Doktor? Kopfschmerzen? Warum halten Sie nicht eine Weile Ihren Mund?«

»Damit Sie nicht zu oft Gelegenheit haben, Ihren zu öffnen.«

Vanderbilt atmete schwer. Er schwitzte. Li bedachte ihn mit einem spöttischen Blick aus den Augenwinkeln und beugte sich vor.

»Sie sagen, es handelt sich um unterschiedliche Codierungen, richtig?«

»Richtig«, nickte Oliviera.

»Ich bin keine Wissenschaftlerin. Aber wäre es nicht denkbar, dass die Codierung den gleichen Zweck erfüllt wie Codes bei Menschen? Codes im Kriegsfall zum Beispiel.«

»Ja«, nickte Oliviera. »Das wäre denkbar.«

»Codes, um einander zu erkennen.«

Weaver kritzelte etwas auf ein Blatt und schob es Anawak hin. Er las es, nickte kurz und legte es wieder beiseite.

»Zu welchem Zweck sollten sie einander erkennen?«, fragte Rubin. »Und warum auf derart komplizierte Weise?«

»Ich denke, das liegt auf der Hand«, sagte Crowe.

Einen Moment lang war nur das Knistern des Zellophans zu hören, das sie von ihrer Zigarettenpackung zog.

»Und was glauben Sie?«, fragte Li.

»Ich glaube, es dient der Kommunikation«, sagte Crowe.

»Diese Zellen kommunizieren untereinander. Es ist eine Form der Unterhaltung.«

»Sie meinen, dieses Zeug …« Greywolf starrte sie an.

Crowe hielt die Flamme ihres Feuerzeugs an die Zigarette, paffte und blies den Rauch aus.

»Es tauscht sich aus. Ja.«

Rampe

»Was war denn los letzte Nacht?«, fragte Oliviera, als sie zum Labor hinuntergingen.

Johanson zuckte die Achseln. »Ich habe nicht die blasseste Ahnung.«

»Und wie geht es Ihnen jetzt?«

»Seltsam. Die Kopfschmerzen lassen nach, aber in meiner Erinnerung klafft eine Lücke von der Größe des Hangardecks.«

»So ein dämlicher Zufall, was?« Rubin drehte sich im Gehen um und bleckte die Zähne. »Da bekommen wir beide Kopfschmerzen. Alle beide! Gott, ich war so platt, dass ich mich nicht mal mehr abmelden konnte. Muss mich wirklich entschuldigen, aber wenn man einmal daliegt … Bäng! Koma!«

Oliviera betrachtete Rubin mit undefinierbarer Miene. »Migräne?«

»Ja. Schrecklich! Kommt und geht. Es passiert nicht oft, aber wenn, ist alles zu spät. Da hilft nur, Zäpfchen rein und Licht aus.«

»Durchgeschlafen bis heute Morgen?«

»Klar.« Rubin sah schuldbewusst drein. »Tut mir Leid. Aber man verliert jede Kontrolle, im Ernst. Sonst hätte ich mich doch mal blicken lassen.«

»Haben Sie das nicht?«

Es klang komisch, wie sie die Frage stellte. Rubin lächelte irritiert.

»Nein.«

»Bestimmt nicht?«

»Das sollte ich eigentlich wissen.«

In Johansons Kopf machte etwas Klick. Wie ein kaputter Diaprojektor. Der Schlitten versuchte ein Bild zu greifen und rutschte ab.

Wozu stellte Oliviera diese Fragen?

Sie machten vor der Labortür Halt, und Rubin gab den Zahlencode ein. Die Tür schwang auf. Während er ins Innere ging und das Licht anmachte, sagte Oliviera leise zu Johanson: »He, was ist los? Sie waren der festen Überzeugung, ihn gestern Nacht gesehen zu haben.«

Johanson starrte sie an. »Ich war was?«

»Als wir weintrinkenderweise auf der Kiste saßen und darauf warteten, dass die Sequenzmaschine ihren Job macht«, flüsterte Oliviera. »Sie sagten, Sie hätten ihn gesehen.«

Klick. Der Schlitten versuchte das Dia zu greifen. Klick.

Sein Kopf war wie mit Watte angefüllt. Sie hatten Wein getrunken, daran erinnerte er sich. Und sich unterhalten. Und dann hatte er … was gesehen?

Klick.

Oliviera hob eine Braue.

»Menschenskind«, sagte sie im Hineingehen. »Sie hat’s ja vielleicht erwischt.«

Neuronencomputer

Sie saßen im JIC vor Weavers Computer.

»Pass auf«, erklärte sie. »Die Sache mit der Codierung, das gibt uns einen völlig neuen Anhaltspunkt.«

Anawak nickte. »Die Zellen sind nicht alle gleich. Sie sind nicht wie Neuronen.«

»Und es ist nicht alleine die Art und Weise, wie sie verknüpft sind. Wenn ihre DNA codierte Sequenzen aufweist, könnte es sein, dass eben darin der Schlüssel zur Verschmelzung liegt.«

»Nein. Die Verschmelzung muss durch etwas anderes ausgelöst werden. Etwas mit Fernwirkung.«

»Gestern waren wir bei Duft angelangt.«

»Okay«, sagte Anawak. »Probier das. Programmier sie so, dass sie einen Duftstoff erzeugen, der ›Verschmelzen‹ signalisiert.«

Weaver dachte nach. Sie rief über das Bordtelefon im Labor an. »Sigur? Hi! Wir sitzen an der Simulation. Habt ihr inzwischen eine Idee, wie diese Zellen miteinander verschmelzen?« Sie hörte eine Weile zu. »Genau. — Wir probieren das durch. — In Ordnung. Sag mir Bescheid.«

207
{"b":"744","o":1}